Melonet DB   for functional genomics study of muskmelon

gene ID search: Go

e-TILLING    for NGS-based in silico reverse genetics screening of specific accession or mutant
query (input):	! ----------------------------------- Disclaimer ----------------------------------- ! This app uses cookie to control data traffic. Please activate it on your browser. ! We will not provide any access information to the third party without any notice. ! ! error : disabled cookie ! ----------------------------------------------------------------------------------
Database:	DNA variant dataset of 320 lines (published data of Zhao et al. 2019, reference=Harukei-3 ver1.41)
cutoff settings:	GATK's GQ :    read depth :    display TOP [x] accessions/mutants in each genotype (html) :
variant report filter:	only variants affecting protein seq variants within gene region all variants including 5 kb flanking
	Search
[INFO] Currently, one dataset is available as a trial. It is based on the NGS dataset of 320 natural accessions (Zhao et al. 2019, Nature Genetics 51[11] 1607-1615).

[! Below is example] Summary | selected DB=[Illumina-based DNA variant dataset of 320 lines (published data of Zhao et al. 2019, reference=Harukei-3 ver1.41)] Query mutant found variant found aa changing nonsense Arabidopsis best homologue Arabidopsis homologue function E-value score MELO3C015737 8 2 7 - => AT3G23240.1 (ATERF1) ethylene response factor 1 1.72E-55 176 MELO3C011364 36 8 14 1 => AT1G78080.1 (RAP2.4) related to AP2 4 1.33E-85 262 MELO3C010195 16 4 8 - => AT1G16060.1 (ADAP) ARIA-interacting double AP2 domain protein 1.43E-112 331 MELO3C007241 26 4 12 2 => AT4G18450.1 Integrase-type DNA-binding superfamily protein 8.40E-47 158 mutant search result (example) *variant with higher [GQ] may be confident (e.g. GQ > 30) *hom-alt=[homozygous ALT], hetero=[heterozygous], hom-ref=[homozygous REF], RC=[reverse complement] Query=[MELO3C015737] | mutant found=[8] | variant found=[2] | homologue of [AT3G23240.1 (ATERF1), ethylene response factor 1] Plant ID DP GQ %ALT Predicted genotype Chr. Pos. REF [RC] ALT [RC] Transcript located at mutation type a.a. change alignment CDS alignment Protein    MS_1035 12 99 58.3 hetero chr01 28119294 G [C] A [T] MELO3C015737.jh1.t1 CDS.1 missense R176W [link] [link]    MS_1043 10 99 40.0 hetero    MS_1037 14 99 50.0 hetero chr01 28119513 C [G] T [A] MELO3C015737.jh1.t1 CDS.1 missense V103I [link] [link]    MS_1035 19 99 42.1 hetero    MS_1064 11 99 36.4 hetero    MS_1043 12 64 25.0 hetero [Back to TOP] Query=[MELO3C011364] | mutant found=[36] | variant found=[8] | homologue of [AT1G78080.1 (RAP2.4), related to AP2 4] Plant ID DP GQ %ALT Predicted genotype Chr. Pos. REF [RC] ALT [RC] Transcript located at mutation type a.a. change alignment CDS alignment Protein    MS_1054 11 99 36.4 hetero chr03 25111088 C T MELO3C011364.jh1.t1 CDS.1 nonsense Q117* [link] [link]    MS_1030 12 96 25.0 hetero chr03 25111091 A C MELO3C011364.jh1.t1 CDS.1 missense I118L [link] [link]    MS_1033 11 99 54.5 hetero chr03 25111101 T C MELO3C011364.jh1.t1 CDS.1 missense V121A [link] [link]    MS_1032 13 99 46.2 hetero    MS_1031 11 99 36.4 hetero    MS_1076 13 39 100.0 hom-alt chr03 25111128 T A MELO3C011364.jh1.t1 CDS.1 missense V130E [link] [link]    MS_850 13 39 100.0 hom-alt    MS_330 12 36 100.0 hom-alt    MS_471 12 36 100.0 hom-alt    MS_546 11 33 100.0 hom-alt other [1] hom-alt...    MS_1071 11 99 63.6 hetero    MS_1066 10 99 50.0 hetero    MS_1060 12 99 58.3 hetero chr03 25111554 C T MELO3C011364.jh1.t1 CDS.1 missense T272I [link] [link]    MS_1025 16 48 100.0 hom-alt chr03 25111578 C T MELO3C011364.jh1.t1 CDS.1 missense P280L [link] [link]    MS_1061 14 42 100.0 hom-alt    MS_270 14 42 100.0 hom-alt    MS_965 14 42 100.0 hom-alt    MS_169 13 39 100.0 hom-alt other [14] hom-alt...    MS_1035 22 99 72.7 hetero    MS_1038 19 99 63.2 hetero    MS_1024 14 99 50.0 hetero    MS_1081 13 99 38.5 hetero    MS_919 12 99 33.3 hetero other [3] hetero...    MS_1032 11 57 81.8 hetero chr03 25111596 A G MELO3C011364.jh1.t1 CDS.1 missense D286G [link] [link]    MS_1032 14 99 64.3 hetero chr03 25111657 G T MELO3C011364.jh1.t1 CDS.1 missense E306D [link] [link]    MS_1033 11 99 54.5 hetero [Back to TOP] Query=[MELO3C010195] | mutant found=[16] | variant found=[4] | homologue of [AT1G16060.1 (ADAP), ARIA-interacting double AP2 domain protein] Plant ID DP GQ %ALT Predicted genotype Chr. Pos. REF [RC] ALT [RC] Transcript located at mutation type a.a. change alignment CDS alignment Protein    MS_1056 15 99 46.7 hetero chr02 13198446 C [G] A [T] MELO3C010195.jh1.t1 CDS.7 missense A302S [link] [link]    MS_1078 10 96 30.0 hetero    MS_1031 11 57 81.8 hetero    MS_1080 13 51 84.6 hetero    MS_1082 10 99 50.0 hetero chr02 13198538 G [C] T [A] MELO3C010195.jh1.t1 CDS.7 missense S271Y [link] [link]    MS_1082 10 99 50.0 hetero chr02 13198539 A [T] T [A] MELO3C010195.jh1.t1 CDS.7 missense S271T [link] [link]    MS_1036 14 42 100.0 hom-alt chr02 13201511 T TATTAAGATGTCCGGAATGTA MELO3C010195.jh1.t1 intron.2 intron | within 2 bp from splicing junction (may affect) - - -    MS_1080 14 99 71.4 hetero    MS_1053 14 99 50.0 hetero    MS_1029 14 99 35.7 hetero    MS_1039 10 99 30.0 hetero [Back to TOP] Query=[MELO3C007241] | mutant found=[26] | variant found=[4] | homologue of [AT4G18450.1, Integrase-type DNA-binding superfamily protein] Plant ID DP GQ %ALT Predicted genotype Chr. Pos. REF [RC] ALT [RC] Transcript located at mutation type a.a. change alignment CDS alignment Protein    MS_1049 15 45 100.0 hom-alt chr08 1657354 A C MELO3C007241.jh1.t1 CDS.1 missense Q7P [link] [link]    MS_1042 11 33 100.0 hom-alt    MS_1040 10 30 100.0 hom-alt    MS_1041 10 30 100.0 hom-alt    MS_748 11 99 45.5 hetero    MS_1060 24 99 41.7 hetero    MS_1043 14 99 28.6 hetero    MS_1035 24 99 25.0 hetero    MS_1029 10 94 30.0 hetero other [1] hetero...    MS_1048 10 30 100.0 hom-alt chr08 1657485 A G MELO3C007241.jh1.t1 CDS.1 missense N51D [link] [link]    MS_1029 12 99 25.0 hetero    MS_1035 20 75 85.0 hetero    MS_1048 10 30 100.0 hom-alt chr08 1657497 G A MELO3C007241.jh1.t1 CDS.1 missense E55K [link] [link]    MS_1062 11 86 27.3 hetero    MS_1035 16 80 81.2 hetero    MS_1030 18 44 94.4 hom-alt chr08 1657935 A G MELO3C007241.jh1.t1 CDS.1 missense M201V [link] [link]    MS_919 12 36 100.0 hom-alt    MS_1043 10 99 40.0 hetero [Back to TOP]

e-TILLING search full result (tab-delimited text, for copy/paste)